This website uses cookies to ensure you have the best experience. Learn more

Bp Workers Iii – Trained For Dangers

836 words - 3 pages

Case Study 4BP Workers III - Trained for DangersAllison EkwereProfessor Dianne DinkelM603: Making Ethical Management DecisionsAugust 8, 2014IntroductionAm I trained for danger? The majority of the workers at Texas City refinery would unfortunately have to reply, "No." The extremely unfortunate event that took place in March 2005, made it exceedingly evident, through investigation, that a lack of knowledge among workers, supervisors, and managers was the predominant cause of this disaster (Belli, 2007). Was the event preventable? Was BP intentionally ignoring all the safety concerns taking place in their organization? Was profit the only focus for BP? Throughout this paper, I will discuss BP's attitude towards its workers, the corporate worldview perceptions about BP's worker safety practices and BP's attitude compared to biblical and historical ethics.An Attitude That IgnoresBP's attitude towards its employees is a negative one. BP was indifferent to all the safety issues taking place in their employees work environment. High-level management, such as executives, was well informed about of the issues at hand; they just refused to be proactive in resolving the predicaments. They received documents explaining how cost cutting had compromised the safety in the refinery years before the incident in 2005, took place. In addition, training was cut from around 30 in 1997, to 8 in 2004, while also fixed costs being cut to approximately 25% from 1998 to 2004 (Mac Sheoin, 2010). The cutbacks lead to workers handling faulty equipment, untrained supervisors, not fully capable to instruct others effectively, and lead to countless safety incidents. BP failed to make certain that their actions of reducing costs did not intentionally harm their employees. BP balanced out the positive outcome, saving money, against the negative outcome, less training and a poor safety environment, which is immoral and not ethical. Profits should not be prioritized higher than human safety.Reports Not FiledBP's attitude towards employee incidents was what you would expect in a developing country sweatshop. Through investigation, it was discovered that "reporting bad news was not encouraged and incidents were often ineffectively investigated and appropriate corrective action was not taken" (Mac Sheoin, 2010, p. 27). In addition, employees were required after many incidents to sign a statement that he or she committed an unsafe act (Mac Sheoin, 2010). This mentality as an organization to ignore incidents and discourage workers to report illustrates BP's attitude towards their employees. "Sweep it under the rug" behavior is what BP endorsed, at the time, which caused a series of catastrophic events. This action should not be ethically...

Find Another Essay On BP Workers III – Trained for Dangers

Incidents With British Petroleum: Profit vs. Safety

1170 words - 5 pages British Petroleum put a monopoly on the oil production in America and consequently neglected to place the environment and the well being of their own workers to their top priorities, therefore people need to know that BP is more focused on profit than safety. People need to be aware that there are more safer alternatives for energy than oil. There has been three separate occasions where BP has purposely overlooked there infrastructure, as well

BP: safety vs. Profit Essay

1165 words - 5 pages British Petroleum put a monopoly on the oil production in America and consequently neglected to place the environment and the well being of their own workers to their top priorities, therefore people need to know that BP is more focused on profit than safety. Also people need to be aware that there are more safer alternatives for energy than oil. There has been three separate occasions where BP has purposely overlooked there infrastructure, as

BP Plc: A Struggling Company in 1909 to the 6th Largest Today

3235 words - 13 pages Refinery plant, was a gain for them, as they have wiped out a competition; the thought of providing safety for their employees never occurred to them. To put it succinctly, globalization led to offshoring, which led to the exploitation of workers. BP has received many criticisms since the Refinery Explosion and many expected the company to promote safety protocols in their plants around the world, but the exact opposite happened when three

communication 121 w.a. 3

1098 words - 4 pages example.The situation I chose for this question deals with the infamous BP oil spill which took place in 2010. The actual incident I singled out did not deal with the entire spill but simply a statement made by BP on a social media site claiming that the oil spill conditions were better than they actually were. The BP public relations campaign had tried to reassure the American people there was nothing to worry about. Their actions during this event

Large British Business Engineering company: British Petrolium

2522 words - 10 pages Employees (Social Factors)Bp provides jobs for local workers all around Britain in the areas where company branches & offices are available.Bp provides heath care & education programs for its employees and their families.Technology is vital to BP's business strategy. It underpins the search for oil and gas. It stimulates innovation. Through it the company can make more efficient use of the resources it has already found. It helps to create

BP Gulf of Mexico oil spill

1093 words - 5 pages million in supplemental appropriations for salaries and expenses. Several Process solutions have come since the BP 4.9 million barrel oil spill. BP was penalized via criminal and civil law suits, to the tune of 17.5 billion in fines. BP is mandated to implement comprehensive compliance audits. High Risk sites are mandated to have oil spill response plan, trained employees, and the necessary equipment to implement a response and contingency plan EPA

Compensation and Cost Cutting: An Example of the BP Company

1151 words - 5 pages million salary and bonuses, 474,384 shares and 2,006,767 options in 2006. Shareholders including senior executives (capital) were the winners but the BP workers, and genuine long term sustainability (labour and society), were the losers. Investigative historian Tom Estimated fees and expenses incurred or to be incurred by BP in connection with the 1998 Merger are approximately $80 million (Amoco and BP Oil, 1998). Bower (2009) writes: After his

The Deepwater Horizon Catastrophe

2502 words - 10 pages business behavior eventually must conflict. (Duska, 2002) Ultimately BP is accountable for the series of negligence, and unethical behavior that resulted in an environmental nightmare. One environmentalist wondered how BP can call itself a “green company” when its environmental record is so poor. (Jennings, 2012, p. 416) According to all accounts, it wasn't just BP, but contractors Transocean, and Halliburton shared some of the blame. Some

BP- Texas City Oil Refinery Explosion (2005) – Case Summary

1660 words - 7 pages maximizing profits. Employees were aware of the working conditions at the plant because every day they were going to work with a fear that something terrible could happen at any time. BP failed to repair a lot of safety problems they knew about, and it led to the explosion in 2005, 15 deaths and over 170 injured. BP reduced its expanses for buying safety equipment for employees, cut its budget to lower number of inspection, and maintenance workers at the

An Analysis of the Dairy Industry

3364 words - 13 pages al., 2010), for partial exon3 of leptin gene, were used to amplify the respective regions in the present study. Table 1: The primer sequence used for the amplification of leptin gene fragments Leptin Gene Primer Sequence (5 ` 3`) Product size in bp Reference Partial Intron2 Forward Primer GCAAGTGACCCTCCCTGCATACC 213 KC415280.1 Reverse Primer CCCCGATTCCGGCTACCTAACT Partial Exon3 Forward Primer GGGAAGGGCAGAAAGATAG 331 Kulig et al., 2010

Irish Scouting

8838 words - 35 pages Scouts, loss in masters, page 42 A mutual relation between France and Ireland, page 43 Independence for IFSGG and BP Scouts, page 44 Criticism of Scouting in Ireland, page 45 PART II: 1939-1945: Scouts in the aid of others: The war, page 48 Scouts fighters, page 49 The memoirs of Patrice Canice O'Mahomy, page 51 Scouts as life savers, page 52 Girl Guides, page 53 Entertainment in need, page 55 Deaths, page 56 The position of

Similar Essays

Oil And Gas Essay

1187 words - 5 pages The Oil and Gas industry is one of the richest industries in the world and over the years they have developed rules and regulation because of the dangers involved in this industry. Dangerous Events Three main injuries occur on oil rigs, loss of hearing, over a period of time the loud noise can harm the hearing even when the workers wear ear protection. Second is body injury ,the oil field is demanding and the workers have to work diligently

Ethics And Negotiation Case Study

2376 words - 10 pages safety reviews by all members of the leadership team, an enhanced safety team for all employees and creation of a full-time safety audit team." (Olsen, 2005)According to Laredo Morning Times (2005), the problem could have occurred because BP officials might have focused too much on individual worker safety that they missed problems with overall system safety. Whilst safety statistics may have improved because more workers were avoiding minor

Bp's Unethical Behavior Essay

963 words - 4 pages last few years; however, there has not been much discussion about the ethical values and behavior of the company. The Government should take action against BP and its executives because the company is acting unethically trying to evade its responsibilities and the consequences of the disaster. It is illicit to make as much money as one can in a business without a care for the environment. Moreover, BP has not accomplished the ethical values that

Bp’s Sustainability Struggle; Overcoming Human Rights Issues Globally.

1118 words - 5 pages government became the main stakeholder in the founding company (AIOC) in light of World War I. Human rights violations can be traced back to this time where Iranian workers lived in what was referred to as “ the paper city” whilst the British officials oversaw them from air-conditioned villas. The inequality was evident and whilst famine and cholera affected the workers they continued to provide the needed fuel for the ongoing World War at the time. The