Bp Workers Iii – Trained For Dangers

836 words - 3 pages

Case Study 4BP Workers III - Trained for DangersAllison EkwereProfessor Dianne DinkelM603: Making Ethical Management DecisionsAugust 8, 2014IntroductionAm I trained for danger? The majority of the workers at Texas City refinery would unfortunately have to reply, "No." The extremely unfortunate event that took place in March 2005, made it exceedingly evident, through investigation, that a lack of knowledge among workers, supervisors, and managers was the predominant cause of this disaster (Belli, 2007). Was the event preventable? Was BP intentionally ignoring all the safety concerns taking place in their organization? Was profit the only focus for BP? Throughout this paper, I will discuss BP's attitude towards its workers, the corporate worldview perceptions about BP's worker safety practices and BP's attitude compared to biblical and historical ethics.An Attitude That IgnoresBP's attitude towards its employees is a negative one. BP was indifferent to all the safety issues taking place in their employees work environment. High-level management, such as executives, was well informed about of the issues at hand; they just refused to be proactive in resolving the predicaments. They received documents explaining how cost cutting had compromised the safety in the refinery years before the incident in 2005, took place. In addition, training was cut from around 30 in 1997, to 8 in 2004, while also fixed costs being cut to approximately 25% from 1998 to 2004 (Mac Sheoin, 2010). The cutbacks lead to workers handling faulty equipment, untrained supervisors, not fully capable to instruct others effectively, and lead to countless safety incidents. BP failed to make certain that their actions of reducing costs did not intentionally harm their employees. BP balanced out the positive outcome, saving money, against the negative outcome, less training and a poor safety environment, which is immoral and not ethical. Profits should not be prioritized higher than human safety.Reports Not FiledBP's attitude towards employee incidents was what you would expect in a developing country sweatshop. Through investigation, it was discovered that "reporting bad news was not encouraged and incidents were often ineffectively investigated and appropriate corrective action was not taken" (Mac Sheoin, 2010, p. 27). In addition, employees were required after many incidents to sign a statement that he or she committed an unsafe act (Mac Sheoin, 2010). This mentality as an organization to ignore incidents and discourage workers to report illustrates BP's attitude towards their employees. "Sweep it under the rug" behavior is what BP endorsed, at the time, which caused a series of catastrophic events. This action should not be ethically...

Find Another Essay On BP Workers III – Trained for Dangers

The Deepwater Horizon Catastrophe Essay

2502 words - 10 pages business behavior eventually must conflict. (Duska, 2002) Ultimately BP is accountable for the series of negligence, and unethical behavior that resulted in an environmental nightmare. One environmentalist wondered how BP can call itself a “green company” when its environmental record is so poor. (Jennings, 2012, p. 416) According to all accounts, it wasn't just BP, but contractors Transocean, and Halliburton shared some of the blame. Some

BP- Texas City Oil Refinery Explosion (2005) – Case Summary

1660 words - 7 pages maximizing profits. Employees were aware of the working conditions at the plant because every day they were going to work with a fear that something terrible could happen at any time. BP failed to repair a lot of safety problems they knew about, and it led to the explosion in 2005, 15 deaths and over 170 injured. BP reduced its expanses for buying safety equipment for employees, cut its budget to lower number of inspection, and maintenance workers at the

An Analysis of the Dairy Industry

3364 words - 13 pages al., 2010), for partial exon3 of leptin gene, were used to amplify the respective regions in the present study. Table 1: The primer sequence used for the amplification of leptin gene fragments Leptin Gene Primer Sequence (5 ` 3`) Product size in bp Reference Partial Intron2 Forward Primer GCAAGTGACCCTCCCTGCATACC 213 KC415280.1 Reverse Primer CCCCGATTCCGGCTACCTAACT Partial Exon3 Forward Primer GGGAAGGGCAGAAAGATAG 331 Kulig et al., 2010

Irish Scouting

8838 words - 35 pages Scouts, loss in masters, page 42 A mutual relation between France and Ireland, page 43 Independence for IFSGG and BP Scouts, page 44 Criticism of Scouting in Ireland, page 45 PART II: 1939-1945: Scouts in the aid of others: The war, page 48 Scouts fighters, page 49 The memoirs of Patrice Canice O'Mahomy, page 51 Scouts as life savers, page 52 Girl Guides, page 53 Entertainment in need, page 55 Deaths, page 56 The position of

Delifrance Service Firm Audit

5715 words - 23 pages a venue that is socially acceptable to friends and colleagues. Emotional benefits relateto the customer feeling comfortable in the dining environment.See Figure 2 for a description of customer traffic by market segment.Figure 2 . Traffic by market segmentDay/Time Monday Tuesday W ednesday Thursday Friday Saturday Sunday7.00am BP BP BP BP BP8.00am Uni, BP Uni, BP Uni, BP Uni, BP Uni, BP Uni, S&T S&T9.00am Uni Uni Uni Uni Uni Uni, S&T S

Short Snippet on The Winter of Discontent (Great Britain, 1978-1979)

579 words - 2 pages The winter of 1978-1979 in Britain was characterized by widespread strikes by trade unions requesting larger wage increases for their members and struggles within the Labour Party. The first line of William Shakespeare’s Richard III was applied to the industrial events happening during that time. The strikes were a result of the government ruling that pay rises must be limited to 5%. The strikes spread from the private sectors to public

BP Deepwater Horizon Oil Spill

2312 words - 9 pages Spill The BP oil spill happened off the United States coast in the Gulf of Mexico and is considered the largest accidental marine oil spill in the history of the petroleum industry. After the oil rig Deepwater Horizon exploded and sunk it continued to leak oil for 87 days until it was capped, which resulted in an estimated 4.9 million barrels of oil leaking into the ocean. The Deep Water Horizon was a semi-submersible, mobile, floating

Ethics Assignment

3373 words - 13 pages success" was made for the seal problem. The workers failed to recognize the first signs of the impending bust-up.The internal management shortage also contribute to the disaster, BP did not have proper controls in order to ensure safety, health and environmental. For the safety perspective, BP did not make the major decisions which sound from an engineering perspective. The main cause is the opaque internal management, with several directors to make

History Repeats Itself

1566 words - 6 pages when the land on the continent was taken from the Native Americans and redistributed. III.     Impact of The Political Order on The Economic Order: IV.      A political order is composed of those institutions within which people gain, wield and influence distributions of power and an economic order is composed of those institutions within which people organize land, labor, and capital for the production and distribution of goods and

BP Oil Spill Crisis

1140 words - 5 pages BP Oil Spill Crisis The Deepwater Horizon was a nine year old, ultra-deepwater, dynamically positioned, semi-submersible, offshore drilling rig built in South Korea. In 2008, British Petroleum (BP) leased it from Transocean to drill for oil in the Gulf Coast. In September 2009, the rig drilled the deepest oil well in history at a depth of 35,055-feet. On April 20, 2010 while drilling the rig exploded at 9:45PM (CST), killing eleven workers

DNA-elektroforese

1829 words - 7 pages ml TAE og 270 ml sterilt vand)Markørblanding (Bromphenolblåt og Glycerol)Sterilt vandStandard DNA prøve (behandlet med λ-Hind III restriktionsenzym) Dette DNA indeholder 48502 bp. Disse er fordelt hovedsageligt på de følgende 7 stykker: 23130 bp, 9416 bp, 6557 bp, 4361 bp, 2322 bp, 2027 bp og et på 560 bp.pUC18 DNA prøve (indkøbt plasmid DNA)Udstyr:StøbekarSlothformer (Kam med 12

Similar Essays

Ethics And Negotiation Case Study

2376 words - 10 pages safety reviews by all members of the leadership team, an enhanced safety team for all employees and creation of a full-time safety audit team." (Olsen, 2005)According to Laredo Morning Times (2005), the problem could have occurred because BP officials might have focused too much on individual worker safety that they missed problems with overall system safety. Whilst safety statistics may have improved because more workers were avoiding minor

Incidents With British Petroleum: Profit Vs. Safety

1170 words - 5 pages British Petroleum put a monopoly on the oil production in America and consequently neglected to place the environment and the well being of their own workers to their top priorities, therefore people need to know that BP is more focused on profit than safety. People need to be aware that there are more safer alternatives for energy than oil. There has been three separate occasions where BP has purposely overlooked there infrastructure, as well

Communication 121 W.A. 3 Essay

1098 words - 4 pages example.The situation I chose for this question deals with the infamous BP oil spill which took place in 2010. The actual incident I singled out did not deal with the entire spill but simply a statement made by BP on a social media site claiming that the oil spill conditions were better than they actually were. The BP public relations campaign had tried to reassure the American people there was nothing to worry about. Their actions during this event

Large British Business Engineering Company: British Petrolium

2522 words - 10 pages Employees (Social Factors)Bp provides jobs for local workers all around Britain in the areas where company branches & offices are available.Bp provides heath care & education programs for its employees and their families.Technology is vital to BP's business strategy. It underpins the search for oil and gas. It stimulates innovation. Through it the company can make more efficient use of the resources it has already found. It helps to create