This website uses cookies to ensure you have the best experience. Learn more

Lab: Exploring Organelle Function Essay

716 words - 3 pages

ABSTRACT:An enzyme is a protein which functions as an organic catalyst, which allows a particular reaction to occur without using itself up in the process. Without enzymes, most reactions in a cell would not occur. Enzymes function best in an acidic environment as do catalase, however the correct concentration of an acidic solution is needed to ensure the most efficient reaction. Placing a catalase enzyme into a solution which is slightly acidic (less than pH 7) produces the best catalytic reaction including foaming and bubbling. There are many different types of enzymes, and all of which operate at peak efficiency in concentrations of acids and/or bases (different pH levels). Some enzymes, like the ones contained in blood cells work best in a neutral environment ( pH 7), but others such as stomach enzymes would work best in a very acidic environment ( pH 1-2). Each enzyme is designed to function best in a certain environment and this is evident through this experiment.INTRODUCTION:An enzyme is a protein which functions as an organic catalyst, which allows a particular reaction to occur without using itself up in the process. Without enzymes, most reactions would not occur. The purpose of this lab is to demonstrate the effect of pH on the efficiency of the catalase enzyme found in potato peroxisomes. I hypothesize that the catalase enzyme of a potato will function the best at the same pH as the material is came from(pH 7, neutral).Null: The enzyme will not work in a solution with a pH which is less than 7 or greater than 7 because it is not adapted to that environment.MATERIALS:60 mL 3% hydrogen peroxide0.5 mol/L hydrochloric solutionpotatopH probe/indicator paperPROCEDURE:Refer to McGraw- Hill Ryerson Biology 11 p.61CONCLUSION:As shown by the observations, the enzymes functioned the best in the middle strength acid. In the first cylinder, the one with the highest concentration of acid, the reaction that occurred was not very impressive. The reaction in the third cylinder, with a neutral pH level was a greater reaction than that of the first but the second cylinder, only slightly acidic had the greatest overall...

Find Another Essay On Lab: Exploring Organelle Function

Diabetes Mellitus Essay

1968 words - 8 pages experimental diabetic nephropathy. Although the large body of evidence about the role of NO in renal physiology and pathophysiology was obtained by exploring the effects of nonspecific NOS inhibitors, more recent studies, using newly available specific inhibitors (9, 10). L-NNA is a nitric oxide synthase inhibitor, as an analog of L- aginine. Slow reversibility of L-NNA-mediated inhibition provides a degree of selectivity for nNOS (neuronal nitric

Genetic Disorder: Adrenoleukodystrophy (ALD) Essay

1599 words - 6 pages function improperly. As a result, it is believed that saturated VLCFAs may not enter the peroxisomes to undergo β-oxidation because of the ALDP being unable to transport the VLCFAs into the peroxisomes causing them to function improperly. Furthermore, there have been experiments on lab mice that are deficient of ALDPs and the results have shown high blood plasma levels of VLCFA in these experimental organisms, but there may be some flaws in the

Microbiology

892 words - 4 pages ). Scientists even consider these studies to be beneficial in regard to the preparation for exploring greater depths of our solar system. The University of North Carolina at Chapel Hill has an ongoing project revolving around Hypsibius dujardini (Gabriel, et al., 2007). Since 2007, The Goldstein Lab on the university's premises has presented tardigrades as a potential microorganism to utilize in studying the evolution of development. They have

Cells, Cancer and Gene Control

2188 words - 9 pages control and are able to invade other tissues” (National Cancer Institute, 2014), exploring the properties of life and cells in the light of their chemical, molecular and compound based composition; their internal and external look (anatomy and physiology); how they function to live (cell respiration, photosynthesis) and divide to grow in numbers (reproductions); and the finally the laws (Mendel’s) structures and functions (DNA) they adhere to will

IB Physics - Electricity Cables (Online) Lab

2163 words - 9 pages Untitled IB Physics HL Lab exploring Electricity Pylon Cables Julia Wuestefeld DESIGN Summary This investigation was carried on with a simulator called Yenka; it will explore the relationship between different lengths of cables (aluminium and copper) and their respective resistance. Through the use of interactive features, the simulator allows for the investigation of what the total resistance of a cable is depending on its

The Zebra Fish and Human Diseases

1935 words - 8 pages isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows: 5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’ 5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’ Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2

Biological and Environmental Factors That Affect Cocaine Sensitivity in Macaques

922 words - 4 pages go beyond the dopamine D2 receptors to observe DAT, D1 and 5-HT. Researchers may want to look at abuse related behaviors such as aggression, cognitive function and impulsivity. This study emphasizes the neurological basis of Psychostimulant abuse while exploring the social and biological aspects that affect addiction. Alan Leshner, in Science, states, “If the brain is the core of the problem [addiction], attending to the brain needs to be a core part of the solution.” The research by Dr. Czoty does just this and uses neuroscience to elucidate the phenomenon of cocaine abuse while paving a path for potential treatments.

Stem Cells, a Titanic Debate of Bioethics

1506 words - 6 pages cells in a lab for a transfusion. The stem cells efficiently produced new cells that could survive transfusion back into the patient’s body and function normally (Prentice). In addition to reprogramming stem cells to become a specialized cell, it is now possible to reprogram somatic cells to become like embryonic stem cells, or stem cells that can become any other cell type. This process is known as induced pluripotent stem cells. The induced

Epithelial Tissue

1295 words - 5 pages ). Question: Choose one of the specific types of epithelial tissue to describe further. How is its structure related to its function? Answer: Simple squamous epithelial tissue is a fascinating tissue. It is a very thin cell layer with “squashed” looking nuclei and scattered cytoplasm. The tissue’s structure (thin and flat) allows the tissue to cover vast amounts of surface area and allows every cell to directly contact the basement membrane. From

QSTR modeling for qualitative and quantitative toxicity prediction of diverse chemical pesticides in honey bee for regulatory purpose

2668 words - 11 pages domain of (quantitative) structure-activity relationship. ATLA, 33, 155-173. Ojha, K., Mitra, I., Das, R.N., Roy, K., 2011. Further exploring r2m metrics for validation of QSPR models. Chemom. Intell. Lab. Syst. 107, 194–205. Panaye, A., Fan, B.T., Doucet, J.P., Yao, X.J., Zhang, R.S., Liu, M.C., Hu, Z.D., 2006. Quantitative structure-toxicity relationships (QSTRs): A comparative study of various non linear methods. General regression neural

The Material Nature of Spirituality

1665 words - 7 pages system make possible enhanced spiritual and religious experiences. Therefore, is there any 'biological' purpose to such behavior, if spiritual behavior and experiences are linked to a material structure, the brain, and the nervous system? Are we literally made for reflection and spirituality? According to Newberg, spirituality has an evolutionary function (1). The brain was evolutionary developed for exploring spirituality and religious

Similar Essays

Causality, Hume, And Quantum Mechanics Essay

1611 words - 6 pages reactions. Cell membrane status, ion flow, neurotransmitter site function and status, internal organelle function would all have to be known. Since each nerve is different, we have to know these factors for every nerve. We can't stop here, each organelle and membrane has internal mechanisms that must be known to fully describe the whole. We would have to know the structure, function, and position of every molecule that makes up that organelle. But to

Description And Analysis Of The Cell Theory

1472 words - 6 pages out all the function necessary for the organism to live and reproduce. Prokaryotic cells are small than eukaryotic cells. Their sizes range from 0.00000787 to 0.007877 inches (Culen “Prokaryotic Cells”). Cells have similar shape, governed by cell wall, but differences between individuals do exist. The prokaryotic cells are mostly spherical or rod shaped, but they can be spiral, curved or irregular. The arrangement of the cells is also

Pathology Of Tay Sachs Disease Essay

1655 words - 7 pages required for a proper function and binding of β-hexosaminidase. β-hexosaminidase is located in lysosomes, an an organelle that normally degrades molecules into smaller monomers that the cell can use and also act as recycling center. Every organelle within the cell has a different function. Each of their functions are managed by multiple proteins formed by multiple genes. Within lysosome, β-hexosaminidase A helps break down a fatty substance called

Photosynthesis And Respiration Essay

1133 words - 5 pages Photosynthesis is a biological process for (mostly) plants to form food by light. Respiration is also a biological process where living organisms inhale oxygen from the atmosphere to be used for food to make energy and exhale carbon dioxide. In this unit we learned about Chlorophyll and Accessory Pigments, the relationship between structure and function in a leaf, the apple juice lab, alternative carbon fixation methods, different plants and