Lecture Notes Biol2202 2017/2018 Lecture Slides

4537 words - 19 pages

BIOL2202 Module 1 Question Archive
Example Question 1
Using standard wobble rules, deduce the minimum number of anticodons that can specify phenylalanine (Phe).
Recommended time to answer: 4 min

Example Question 2
The active site of an essential enzyme present in Candida albicans has the highly conserved amino acid sequence shown below. Calculate the number of different codon combinations that could encode this active site (show your reasoning, but do NOT write out each sequence).

Lys-Met-Leu-Arg-Trp-Ser

Recommended time to answer: 4 min

Example Question 3
List the components of a cell-free protein synthesising system, and explain the experimental set-up when such a system was used to deduce the genetic code using poly(C) as synthetic RNA.

Recommended time to answer: 4 min

Example Question 4
Why is the genetic code said to be ?standard? but not ?universal?? Illustrate your answer with a comment on start codons used by prokaryotes.
Recommended time to answer: 4 min

Example Question 5
Using standard wobble rules, deduce all possible anticodon sequences that can be used to specify arginine (Arg).
Recommended time to answer: 5 min

Example Question 6
The active site of an essential enzyme present in Homo sapiens has the highly conserved amino acid sequence shown below. Calculate the number of different codon combinations that could encode this active site (show your reasoning, but do NOT write out each sequence).

Ile-Gly-Met-Arg-His-Gln

Recommended time to answer: 4 min

Example Question 7
List the components of a cell-free protein synthesising system, and explain the experimental set-up to deduce the amino acid encoded by the codon AAA.
Recommended time to answer: 5 min

Example Question 8
Why is the genetic code said to be ?standard? but not ?universal?? Illustrate your answer with a comment on the genetic code in Candida albicans.
Recommended time to answer: 4 min

Example Question 9
The following sequence represents a stretch of double-stranded Candida albicans DNA that comes from the middle of a large open reading frame. It is known that this part of the ORF encodes a residue that directly participates in the formation of a disulfide bond.

CCGTCAACCAGAACACAGAGATACT

a) Indicate which reading frame encodes the protein.

b) Deduce as much of the amino acid sequence of the polypeptide as possible.

c) Indicate the residue that may play a role in the formation of the disulfide bond.

Recommended time to answer: 10 min

Example Question 10
It is known that one strand of the following stretch of DNA encodes a serine-rich region from an enzyme in Arabidopsis thaliana.

CGTCAAGTAGCGGGTCGCGTTCC

a) Indicate which reading frame encodes the protein, and deduce as much of the amino acid sequence of the polypeptide as possible. Show all working.

b) If this sequence were expressed in Candida albicans, would it encode the same protein sequence?...

Find Another Essay On Lecture Notes BIOL2202 - 2017/2018 - Lecture Slides

teaching style of Australia Essay

1369 words - 6 pages Introduction: This was my first semester and when I came here, I got to know that the teaching style of Australia is way different compare to my home country. Following report shows the content which I learnt during the semester, apparently I have divided the unit in three parts. Seminar 1 and 2: To be familiar in course I thought that I should be well prepared before going in the lecture, so I had read week one and two lecture slides

Effective Lecturing Skills Essay

1043 words - 5 pages must identify key points. He must be relevant to the audience and he must be clear. The lecturer should be humorous and to improve clarity he must use understandable slides. The lecture format must include a case based approach including Board simulation. To further use the case based format the lecturer should use ARS before the test, during the test and after the test (Copeland, Longworth, Hewson & Stoller, 2000). The main idea of his paper is

How to Give a Lecture

3022 words - 12 pages , when you stick to a script you forfeit the expressiveness, animation, and give-and-take spontaneity of plain talking. Reading from notes also reduces your opportunities to engage your class in conversation and prevents you from maintaining eye contact. On this point all skilled speakers agree: don't read your presentation. See "Preparing to Teach the Large Lecture Course" for advice on preparing lecture notes. Prepare yourself emotionally

Westphalian state system's relevance in contemporary International Relations - Monash & International Relations - Essay

950 words - 4 pages , Monash University), 5/3/18, Lecture] [9: Devetak, Richard. An Introduction to International Relations: The Modern State. University Printing House Cambridge CB28BS United Kingdom: Cambridge, November 2017.] Conversely, scholars have declared the system’s erosion in the face of expanding globalization, resulting in pooled and ceded sovereignty. The intergovernmental United Nations (UN) influences domestic policies, illustrated by the 64

Digital music sales in 2011 outstripped physical sales for the first time ever

805 words - 3 pages Innovation and Teamwork CMOD6001(Lecture Slides & Notes)Books:Isaacson, W (2011)Steve Jobs: The Exclusive Biography.UK EditionLittle Brown.Press Conferences:Apple Special Event, (2003)Moscone West, San Francisco.16 October 2003.Websites:BusinessWeek-Boston Consulting Group (2007)Most Innovative Companies survey of senior executives (2007)Available at: http://images.businessweek.com/ss/07/05/0503_innovative_co/source/2.htm

I-Notes arent so bad

530 words - 2 pages I-Notes Aren’t so Bad      In the article, “Disappearing Ink”, Todd Gitlin discusses StudentU.com, a website that sells lecture notes from over 60 different universities. These notes, taken by graduate students, very thoroughly summarize the lectures. This website and others similar to it are creating controversy in many universities. Gitlin, being an experienced professor, writes from experience saying that some

EFFECT OF PPT ON STUDENTS' LEARNING

2172 words - 9 pages PowerPoint as a teaching aid was observed since its introduction in 1997. In the initial years, the response from the students was highly positive. This could be acknowledged from the higher grades, increase in attendance and reduction in disruptive behaviour, when compared to other mediums like the blackboard and transparent overheads.But, there was also a study which showed that the students' performance depended on the difficulty of the lecture

My published work

5801 words - 23 pages course website prior to class and took notes during the class. The lecture consisted of 30 slides, which covered business commu- nication processes, how business consumers make pur- chase decisions, and a demonstration of how to work a multi-attribute problem. The problem worked out in the lecture class was the same problem presented to the POGIL class in Section B. At the end of each session, students were told which pages to read in the text as

Anatomy exam 2 reproductive system - anatomy and phisiology - study guide

635 words - 3 pages following it in the lecture slides) (iii) Figure 21.3: Lymphatic Capillaries For Exam 2, you must: 1. Understand the difference between the two circuits of the cardiovascular system (pulmonary vs. systemic). 2. Understand the location, structure and function of the pericardial sac 3. Understand the location, structure and function of the atrioventricular valves and the names of each: tricuspid and mitral/bicuspid valves 4. Understand how the

Global economics

879 words - 4 pages models, the international dependence model, the neoclassical counterrevolution, the solow neoclassical growth model)Lecture notes on Krugman-Vernonian Product Cycle and Mahalanobis modelModule 5: Pareto Optimality: Efficiency and EquityPhotocopies circulated with the chapter heading 'Exchange'Module 6: Understanding GlobalisationPhotocopies of Chapter 2 'Globalization of Markets and Internationalization of Firms'2 photocopies covering all the

effects of AI and AV on society - tcc - blog

576 words - 3 pages /201827-ENGR-2392-003/2489-15.pdf. · Worsdorfer M. (2017) Lecture X [PowerPoint Slides] https://ttu.blackboard.com/bbcswebdav/pid-3046650-dt-content-rid-16628873_1/courses/201827-ENGR-2392-003/Engineering%20Ethics%20Fall%202017%20Lecture%20X.pdf

Similar Essays

Lecture Notes And Thoughts On "Frankenstein" (Both The 1931 Film Version And Shelley's Novel) And Also Gothic Theory

2057 words - 8 pages Lecture Notes on "Frankenstein" and the Gothic- Generally features strong elements of the supernatural, psychotic, sexually perverse or a combination of all three.- Gothic usually featured dark, brooding setting: Damziels in distress.- When Shelley wrote "Frankenstein" Gothic had gone out of fashion.- 1818 Gothic played for laughs or reanimation.- Shelley: no clear distinction between good and evil.- She updates Gothic out of medieval world into

Summary Of Zachary Beaver Part 4 English 101 Lecture Notes

1026 words - 5 pages Week 21 Bookclub (BC) When Zachary Beaver Came to Town ?1 Check Homework (1 minute) Read Pages 176~227 (Ch.17~22) Book Review (25 minutes) Chapter 17 ? Dad and Toby barely speak to each other day after the Wayne?s funeral. ? Toby and Ferris are the only ones who did not attend the funeral ? Toby works at Bowl-a-Rama for 1 day because worker is sick ? Sheriff Levi breaks the news that he called social services to pick up ZB since

Lecture Notes On Plant Structure (Download Document It Is In A Table.)

821 words - 3 pages PLANT STRUCTUREAngiosperms /MagnoliaphytaTwo groupsDicots and MonocotsAre classified by following features MONOCOTS DICOTSSeed leaves One cotyledon Two cotyledonLeave veins Parallel Network of veins usually branchedStems Random veins (vascular bundles)Complex arrangement Veins (vascular bundles)are arranged in a ringFlowers Multiples of three Multiples of four or fiveRoots Fibrous root system Taproot system(long roots)THE PLANT BODY CONSISTS OF

Notes From A Lecture On Karl Marx And The Communist Manifesto

815 words - 3 pages Why would people stay behind, when they heard the warnings that they might be flooded.25% of the people in N.O. didn't have a car.. and struck @ a ad time of the month.. toward the end of it..food stamps/ unemployment stamps were coming soon.Economic Determinism- Defines/ shapes how we have to live out lives... our ability to work/ buy sell goods and our material possessions.What else determines one's way of life? (clearly economic determinism is