This website uses cookies to ensure you have the best experience. Learn more

Quantitative Real Time Pcr Assay For Differentiation Between Pneumocystis Jirovecii Pneumonia And Colonization

1001 words - 5 pages

Materials and Methods
The present study was conducted at the Parasitology Laboratory, Department of Microbiology, of our tertiary care referral centre.

a. Patients and clinical samples
During the 5 year study period (Feb 2007 to Dec 2012), a total of 355 patients including both HIV sero positive and non-HIV immunocompromised patients with pulmonary infection clinically suggestive of PCP attending to various OPD and/or admitted to our tertiary care centre were enrolled.

Among these 355 patients, 106 were HIV seropositive patients (n=106) and remaining 249 were non-HIV immunocompromised patients. These non-HIV immunocompromised patients were further subdivided into post-renal transplant (PRT) recipients (n=66), cancer patients on chemotherapy (n=84), patients with various primary immunodeficiencies, and autoimmune disorders (n=99). From these 355 patients, equal number (n=355) samples were obtained that included, 244 bronchoalveolar lavage (BAL) fluid and 111 induced sputum (IS).
Demographic profile, clinical characteristics, laboratory findings and radiological findings of each patient were collected prospectively during the course of study. The study was approved by the institute’s research and ethics committee.

b. Clinical Sample Processing and DNA extraction:
All the BAL fluid samples were directly centrifuged at 4000 rpm at 4oC for 10 min. However, sputum samples were first treated with 6.5 mM dithiothreitol (DTT), a mucolytic agent and then subjected to centrifugation. The pellet obtained was resuspended in 20% of the supernatant and 100 µl of this suspended pellet was used for preparation of smears.

For DNA extraction, 200 µl of pellet was lysed using 200 µl of a sample-specific lysis buffer (50 mM KCl, 15 mM Tris-HCl (pH 8.3) and 0.5% NP 40) [Lee et al 1993] containing 500 mg of proteinase K. DNA extraction was performed using Qiagen tissue kit (Qiagen, USA).

Microscopy diagnosis:
Smears were prepared from all the samples. Smears were stained using Grocott’s methenamine silver (GMS) staining. All the stained slides were examined by two experienced microbiologists independently without prior knowledge of PCR results.

Conventional PCR (c-PCR) assay:
c-PCR was performed using highly conserved region of mitochondrial large sub-unit ribosomal RNA (mtLSU rRNA) gene of P. jirovecii. The following set of published primers pAZ 102 E and pAZ 102 H (Wakefield et al 1990), were used that amplify a 346 bp region of the gene.

Real-time PCR (qPCR) assay:
DNA extracted from all the clinical samples were subjected to qPCR assay targeting the single copy gene Beta-tubulin gene.
The set of primers used were as described by Nahimana et al 2000 for c-PCR and Brancart et al 2005 for qPCR targeting Beta-tubulin gene. However, the probe used was with slight modification. The probe was FAM – MGB probe, with the product size of 74bp. The sequences of forward and reverse primers; and probe used were as follows F-(1186-5’) GATCCGAGACATGGTCGCTATT,...

Find Another Essay On Quantitative real-time PCR assay for differentiation between Pneumocystis jirovecii pneumonia and colonization

Species-specific PCR based assay for detection of Phomopsis azadirachtae causing die-back disease in Azadirachta indica

1943 words - 8 pages ) was used in each experiment to test for the presence of contamination in reagents. DNA from P. azadirachtae isolate KA 01 was used as positive control. PCR products were analyzed by electrophoresis in 2% (w/v) agarose gel in 0.5x Tris Borate-EDTA buffer and stained with ethidium bromide (5µg ml-1) and visualized under UV light. Comparison between seed plating and PCR based assay To evaluate the percentage of infection, a total of 100 naturally

Species-specific PCR based assay for detection of Phomopsis azadirachtae causing die-back disease in Azadirachta indica

618 words - 3 pages mentioned primers is not possible. However, species specific primers are not available for specific detection of P. azadirachtae till now. Thus, the objectives of the current study were (i) designing species specific primers for P. azadirachtae (ii) evaluation of its specificity and sensitivity (iii) detection of pathogen in naturally and artificially infected neem seeds and twigs (iv) comparing the efficiency of PCR based assay over seed plating assay.

Difference between Qualitative and Quantitative Research

610 words - 2 pages methods?'At the most basic level, quantitative research methods are used when something needs to be measured, while qualitative methods are used when a question needs to be described and investigated in some depth. Often, the two methods are used in tandem to provide measurements for comparison and evaluation and to give an in-depth explanation of the meaning of an idea.Quantitative researchThe words themselves hold the clues. Quantitative

Time-Predictable Network for Real-Time Data-Centric Computing

1290 words - 5 pages , these time-sensitive streams demand the real-time response from the data centers, which becomes an important challenge to the next generation data center network. For instance, health care imaging systems illustrate the need for both high data rates and real-time cataloging. Also, high energy physics experiments, which generate high rates and massive volumes of data that must be processed and archived in real-time [2]. In the past decades, a lot

The Connection between Slavery, Growth of Capitalism, and Colonization

1331 words - 6 pages and not just a class in itself – a class that that can fight for the social revolution. (Alexander, 2002) In conclusion, there is a stark connection between slavery, the growth of capitalism, and colonization. Both Robinson and the radical revisionists affirm that slavery and other forms of forced labour, such as the indentured workers from India, expanded capitalism. One cannot view the growth of capitalism without taking into account the

Spanish and English Colonization Compare and Contrast the Spanish and English motives for colonization

653 words - 3 pages The main Spanish motives for colonization were for Gold, God and Glory.Many European nations were beginning to look towards new lands after the catastrophic bubonic plague that killed more than a third of the people on the continent and damaged the already weak economy.The first motive of the Spaniards was to become one of the prominent sea faring nations in order to compete with Portugal then the preeminent maritime most powerful seafaring

Selective Encryption Algorithm for Highly Confidential Real Time Video Applications

1126 words - 5 pages others. Combining these properties suggests selective encryption, the idea that a compressed bitstream can be adequately secured from eavesdroppers with only part of the bitstream encrypted. Reducing the fraction encrypted can help to reduce the total complexity of implementation which leads to reduce the encryption and decryption time. Selective encryption has been suggested for a number of specific real time applications [1, 2]. The survey given

Selective Encryption Algorithm for Highly Confidential Real Time Video Applications

1442 words - 6 pages selective encryption, the idea that a compressed bitstream can be adequately secured from attackers with only part of the bitstream encrypted. The reduction of the fraction of encryption can help to reduce the overall complexity of the application leading to reduced encryption and decryption time. Selective encryption has been suggested for a number of specific real time applications [1, 2]. The survey given by F. Liu and H. Koenig [2], shows that

A rugged, precise and accurate new gravimetry method for the determination of gold: an alternative to fire assay method

872 words - 4 pages the determination of gold in small scale or trace amounts like that of atomic absorption spectroscopy (AAS). The demand for gold is rapidly icreasing world wide and as of today, the standard test for its determination is Fire Assay ASTM E 1335-08 – a method that requires expertise, time, and can lead to a decrease in the sample’s amount. In this study, Gold – a rare metal known for its worth, value, and properties such as conductivity

Differences in Qualitative and Quantitative Research methods for business

662 words - 3 pages or a direct mail initiative to consumers in PiggyBank's target market. We would then log the information and produce the results for their management team. I believe the quantitative method is less expensive and less time consuming.There are several cons or issues that need to be considered when deciding which method to use. Most companies and businesses rely on quantitative research because there is less room for error. Qualitative research

The Real Benefits of Part-time and College Students

982 words - 4 pages time management and organizing give is making the right decisions and it also helps students rest their minds so they will not go crazy. Although, time management is real important in our everyday aspect the best benefit is not managing time but where students learn it from. The most important thing of a part-time job with college students is that they will gain experience from their job which will help them for future references. Imagine two

Similar Essays

Quantitative Real Time Pcr Assay For Differentiation Between Pneumocystis Jirovecii Pneumonia And Colonization

1128 words - 5 pages From 355 patients enrolled, there were only 80 patients positive for P. jirovecii specific DNA using qPCR assay and were included for the further analysis. The four patients that were positive by c-PCR and negative by qPCR were considered negative for PCP. Thus, the remaining 275 patients were considered as negative for PCP. The demographics profile and clinical characteristics of PCP positive and negative patients were shown in Table No. 1. On

Relative And Absolute Quantitative Real Time Pcr

2201 words - 9 pages of Immunological Methods, 354 (1–2), pp.34-39. Hu, B., Sellers, J., Kupec, J., Ngo, W., Fenton, S., Yang, T.Y. & Grebanier, A. (2014) 'Optimization and validation of DNA extraction and real-time PCR assay for the quantitative measurement of residual host cell DNA in biopharmaceutical products'. Journal of Pharmaceutical and Biomedical Analysis, 88 (0), pp.92-95. Kim, J., Lim, J. & Lee, C. (2013) 'Quantitative real-time PCR approaches for microbial

Differentiation Between Women's Work And "Real Work" In Munro's "Boys And Girls" And Weldon's "Weekend"

1169 words - 5 pages it. She just did it." (Weldon 5)Also important is the fact that because Martha is punished because she has sought meaningful work outside the home, has attempted to cross the boundary between inside and outside. Because she has taken a job, she has to pay for the cleaning woman who comes in to "replace" her, and because her husband seems to prefer homemade foods and wine, Martha is not permitted the luxury of buying the things she hasn't time to

Kinetics Of Parasitic Load In Different Tissues Of Murine Toxoplasmosis After Immunization By Excretory Secretory Antigens Using Real Time Q Pcr

1201 words - 5 pages rapid, reliable and highly sensitive method to detect and determine the parasite load in biological samples [25]. Lin et al. (2000) showed that Real-time Q-PCR was a sensitive, fast and specific method for evaluation of parasite load, also suggested that this approach could be a proper alternative for routine screening in clinical laboratories [16]. Noroz et al. (2010) in a study on following of T. gondii in different tissues of rat using Real