This website uses cookies to ensure you have the best experience. Learn more

Species Specific Pcr Based Assay For Detection Of Phomopsis Azadirachtae Causing Die Back Disease In Azadirachta Indica

1943 words - 8 pages

Fungal cultures and isolation of fungal DNA
P. azadirachate isolates used in this study were isolated from infected neem seeds and twig material (Table 1) as described by Sateesh [37] and maintained on PDA slants at 4o C until use. Other fungal isolates were collected from different sources (Table 2).
For isolation of DNA from fungal isolates, five mm diameter agar plug containing mycelia was inoculated in 250 ml conical flasks containing 100 ml of potato dextrose broth and incubated at 25±1°C for 10 days in alternate period of bright light and dark. DNA was extracted from 100 mg of the dried mycelium, ground in liquid nitrogen using mortar and pestle according to the procedure described by Raedor and Broda [31] and slightly modified by Chowdappa et al. [6]. DNA was stored at -20ºC until further use. DNA concentration, yield and quality parameters based on absorbance at 260 and 280nm (A260/280 ratio) was estimated.
PCR amplification of ITS region and sequencing
DNA from all the isolates of P. azadirachtae was amplified by PCR with ITS1 and ITS4 primers as described by White et al. [48]. The PCR products were outsourced for sequencing (Bioserve Technologies, Hyderabad, www.bioserveindia.com). The sequences were queried in BLAST search (www.ncbi.nlm.nih.gov) to confirm that it has homology identical to the previously reported rDNA sequences of Phomopsis. The ITS sequences of all the isolates were deposited in the GenBank (www.ncbi.nlm.nih.gov) with accession numbers as mentioned in the table1.
Validation of genus specific primers
The genus specific primers reported earlier in the literature, Phf/Phr [29] and PF1/PF2 [14] were validated using DNA of ten different Phomopsis species (Table 2) including P. azadirachate. The PCR conditions were same as described by Prasad et al. [29] and Girish et al. [14].
Design of P. azadirachtae specific primers
A pair of P. azadirachtae specific primers, referred to as PA primers were designed from the ITS region of rDNA of the P. azadirachtae isolates. ITS sequences of P. azadirachtae isolates along with other Phomopsis species available in Genbank were aligned through Clustal W in Bioedit version 7.0.4.1. The forward primer PAF (5’- CCCTAGGGGGCCCCTCGG-3’) and the reverse primer PAR (5’-AGGGCCTGCTTTTGGGT-3’) were designed manually from the region conserved to P. azadirachtae and variable in other Phomopsis species. The Primers were checked for hairpin formation, Self-dimer, Hetero-dimer, G/C content and melting temperature using oligoAnalyzer 3.1 software (http://eu.idtdna.com/analyzer/applications/oligoanalyzer/).
Development of PCR assay specific for P. azadirachtae
The annealing temperature of PAF/PAR primer was determined by performing a gradient PCR between the annealing temperatures of 55°C - 65°C with the following conditions. PCR was performed in 50 μl reaction volume consisting of 1µl of template DNA, 5 μl 10x PCR buffer, 40.75 μl sterile distilled water, 1 μl 2.0 mM dNTPs, 1μl each of 50 pM primers...

Find Another Essay On Species-specific PCR based assay for detection of Phomopsis azadirachtae causing die-back disease in Azadirachta indica

Fluorescence-Based Detection Methods for Drug Discovery

1410 words - 6 pages Mini-REVIEW IRAK4: FLOURESCENCE-BASED DETECTION ASSAY METHODS FOR DRUG DISCOVERY PROCESSES By Rudo Mafondokoto Introduction: Cancer, neural disorder, inflammatory diseases and metabolic problems are some of the Pathological conditions in which protein kinases are involved in. Therefore this makes protein kinases such as IRAK-4 one of the most promising groups of drug targets. Irak-4 stands for (interleukin-1 receptor-associated kinase

The Role of Ethics in Bringing Extinct Species Back to Life

1434 words - 6 pages Bringing Them Back to Life, an article written by Carl Zimmer for National Geographic April 2013 edition, discusses the possibilities in modern science to clone and revive species that have been driven to extinction in the past ten thousand years (445). Throughout this article, the author makes use of the rhetorical devices logos, ethos, and pathos to argue to an audience that humans have an obligation to revive species which have been

audio Based Event Detection in Videos - A Survey

816 words - 4 pages is to find a mapping from the feature space to the target labels so as to reduce the prediction error. The general system components of the audio based video event detection is presented in Figure 1. The major components of the system are the audio data representation and learning methodologies. An audio signal can be represented by many number of features. Audio feature extraction is an important phase for any type of audio data. It is process

audio Based Event Detection in Videos - A Survey

698 words - 3 pages the maximum and minimum samples within non-overlapping frames. They are suitable for comparing waveform. Amplitude Descriptor (AD) are the ones that have been developed to recognize sounds of the animal. The descriptor is the one that separates the signal with low and high amplitude by an adaptive threshold. AD signifies the waveform in both quiet and loud segments. 3) Power Based Features: The energy of a signal is defined as the square of the

Trust Based Misbehavior Detection in Wireless Sensor Networks

1749 words - 7 pages III. Problem Statement This paper focuses on modeling and calculating trust between nodes in WSNs, based on sensed continuous data to address security issues and deal with malicious and misbehavior nodes and for assisting the decision-making process. A new trust model and a reputation system for WSNs can be proposed. The trust model establishes the continuous version of the reputation system applied to binary events and presents a new trust

audio Based Event Detection in Videos - A Survey

906 words - 4 pages and Table IV shows the comparisons, data sets and references. A. Hidden Markov model Hidden Markov models have been extensively used for modeling the temporal dynamics of varying length patterns of short duration. A HMM is a finite state machine characterized by the number of states in the model, the state-transition probability distribution, the observation symbol probability distribution for each state, and the initial state probability

Information Theory & Optimization for Location of Sensors in Water Distribution for Contaminant Detection

3483 words - 14 pages Numerous water supplies exceed this level. When TDS levels exceed 1000mg/L it is generally considered unfit for human consumption. There is TDS detector sensors. Coliforms are a broad class of bacteria found in our environment, including the feces of man and other warm-blooded animals. The presence of coliform bacteria in drinking water may indicate a possible presence of harmful, disease-causing organisms [31]. Escherichia coli (commonly

FISH Technique: A Powerful Technique for the in Situ Detection of Organisms in Environmental Samples

578 words - 3 pages FISH is a powerful set of technique for the in situ detection of active growing organisms in environmental samples, a procedure that allows researchers to locate the positions of particular DNA or RNA sequences in the cytoplasm, organelles or nucleus [59]. In FISH a labeled DNA or RNA sequence is used as a probe to identify or quantify the natural occurring counterpart of the sequence in a biological sample. FISH probes often target sequences of

Wi-Fi Based Spy Robot Controlled Using Android Application and Implementing Face Detection for Enhanced Surveillance

1936 words - 8 pages in object descriptors and detectors. These functionalities make it easier to implantation of an algorithm for detection of various components in images. V. PROPOSED TECHNIQUES IN FACE DETECTION UNIT The Proposed techniques are aimed at reducing or eliminating influence of external factors that hinder general FD system performance. A. Proposed HYCgCr Color Space To detect facial region in the image from cluttered background, this robust background

A summary analysis of the article “Microarray detection of food-borne pathogens using specific probes prepared by comparative genomics.”

1823 words - 7 pages Introduction: In the field of public health, food-borne illnesses are a major concern because it has been estimated that each year 76 million cases occur in the United States causing 5,000 deaths (Suo et al., 2010). In 2008, the Center for Disease Control and Prevention’s FoodNet surveillance program reported over 18 thousand cases of food-borne illnesses occurred in 10 states (Center for Disease Control and Prevention [CDC], 2008). According

Optimization of Asymmetric PCR for Generation of a Single Stranded DNA Library

1259 words - 6 pages non-equal amounts of the reverse and forward primers for amplification in asymmetric PCR method (18) could provide a diverse SELEX pool of uniform ssDNA structures. Several reports are available on the attempts made to reduce the formation of non-specific products during ssDNA amplification by asymmetric PCR (20). The factors that influence the specificity and amount of amplified DNA by PCR are annealing temperature, MgCl2 concentration and the

Similar Essays

Species Specific Pcr Based Assay For Detection Of Phomopsis Azadirachtae Causing Die Back Disease In Azadirachta Indica

618 words - 3 pages mentioned primers is not possible. However, species specific primers are not available for specific detection of P. azadirachtae till now. Thus, the objectives of the current study were (i) designing species specific primers for P. azadirachtae (ii) evaluation of its specificity and sensitivity (iii) detection of pathogen in naturally and artificially infected neem seeds and twigs (iv) comparing the efficiency of PCR based assay over seed plating assay.

Antifungal Activity Of Botanicals On Neem Die Back Pathogen P. Azadirachtae

591 words - 3 pages Neem (Azadirachta indica A. Juss.) is a divine tree and a sacred gift of nature. It belongs to the family Meliaceae. It is well known for its medicinal and biopesticidal properties (NRC, 1992; Jayaraj, 1996; Rembold, 1996; Hashmat et al. 2012). Even with all its antimicrobial properties, it is not free from microbial diseases (Anonymous 1992; Tewari 1992). Die-back of neem caused by Phomopsis azadirachtae (Sateesh et al. 1997), is a devastating

Quantitative Real Time Pcr Assay For Differentiation Between Pneumocystis Jirovecii Pneumonia And Colonization

1001 words - 5 pages -PCR and Brancart et al 2005 for qPCR targeting Beta-tubulin gene. However, the probe used was with slight modification. The probe was FAM – MGB probe, with the product size of 74bp. The sequences of forward and reverse primers; and probe used were as follows F-(1186-5’) GATCCGAGACATGGTCGCTATT, R-(1257-5’) TTCAACCTCCTTCATGGAAACAG and P-(1217T-5’) FAM-CAGCGATTTTCCGCGGTA- MGB, for the Accession No. AF170964. The qPCR assay was performed in a 25 μl

Quantitative Real Time Pcr Assay For Differentiation Between Pneumocystis Jirovecii Pneumonia And Colonization

1128 words - 5 pages From 355 patients enrolled, there were only 80 patients positive for P. jirovecii specific DNA using qPCR assay and were included for the further analysis. The four patients that were positive by c-PCR and negative by qPCR were considered negative for PCP. Thus, the remaining 275 patients were considered as negative for PCP. The demographics profile and clinical characteristics of PCP positive and negative patients were shown in Table No. 1. On