The First Essay

820 words - 4 pages

The problem of evil is often used by atheists as an escape from acknowledging the Lord (Elwell 2001). The unbeliever does fairly question the motive of an all loving God allowing evil to supposedly prevail in this world. He or she wants and explanation of why God would allow natural and moral evils to continue, seemingly, undaunted and unchecked by our invisible God. Anyone considering the truth of a Christian’s claim to have a personal relationship with the Almighty often fails to see the logic of faith and misunderstands the internal consistency that does in fact stand in harmony when considering the ultimate plan of God.
The Bible is the only authority that is needed to render a truthful explanation of all of these seemingly contradictory problems of evil. First, however, it is helpful to use sources outside of the Bible to define various terms and then the answers can be sought from God’s word.
The ‘problem of evil’ is the attempt to understand the reason and existence for evil by various authorities throughout generations such as theologians and philosophers (Elwell 2001). It has many faucets and also depends in understanding what ‘internal consistency’ means: To question if a “theological position” “contradicts itself” (Elwell 2001, 414). There are two types of evil that need to be defined. First, natural evils are such that are outside of responses to a consequence for evil actions. For example, it is considered natural evil if a tsunami takes the lives of thousands seemingly indiscriminately men, women, and children. Second, moral evil is such that is the consequences of abuse of free will. For example, it is considered a moral evil committed when a parent leaves a child to starve to death when the home has a cupboard full of food.
The bible more than adequately supplies reason and answers to the “problem of evil”. I believe it is a fallacy to even approach evil as a problem. That would not be an internally consistent theology.
One, God not only allows evil, but even created it himself. God himself said “I form the light, and create the darkness: I make peace, and create evil: I the LORD do all these things” He knows both good and evil . This truth in no way deters from God being loving. God stands outside our understanding and even...

Find Another Essay On the first essay

‘Only the type-identity theory can secure the causal efficacy of the mental’ Discuss - University of Nottingham Philosophy Undergraduate First Year - Essay

1513 words - 7 pages ‘Only the type-identity theory can secure the causal efficacy of the mental’ Discuss In my essay I will argue that type-identity is the only theory that can secure the causal efficacy of the mental. I will first present the Identity theory as a theory for mental causation. I will then look to object this theory with the Functionalist position and Cartesian Dualism. However, I hope to show in what follows, that the type-identity theory provides

Essay - What are the audience’s first impressions of Macbeth and Lady Macbeth? Macbeth, is a story which is full of deception, greed and karma

764 words - 4 pages Essay - What are the audience’s first impressions of Macbeth and Lady Macbeth? Macbeth, is a story which is full of deception, greed and karma. This story will thrill the audience's minds and will also teach them about life. During the first act of the play, Macbeth encounters the three deadly, vicious, selfish witches, who consider themselves superior, ‘Lesser than Macbeth, and greater’ The witches say this particular dialogue when Macbeth

The first 1000 lines of the human genome - UGA - Essay

1008 words - 5 pages Human Genome: First 1000 lines of Chromosome 1 GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA

Soliloquies Essay - Importance of the First Soliloquy in Macbeth

1484 words - 6 pages Importance of the First Soliloquy in Macbeth        Following king Duncan's arrival at Inverness, Macbeth delivers his first major soliloquy. This speech summarizes his reasons for not wanting to commit murder. It is also an image of the plot of Macbeth, as it foreshadows the chain of events that is to follow the murder of Duncan. Although Macbeth knows that he cannot "trammel up the consequence" of Duncan's murder

A Hero's First Death, an essay on Homer's The Odyssey

830 words - 3 pages A Hero's First DeathDavid Blumenthal In two of the founding stories of our culture, there seems to be a requirement that peoplewho have experienced something horrible cannot establish a proper home. In the Bible, theIsraelites wandered through the desert for 40 years to ensure that an entire generation passed andnone of the people who were slaves in Egypt saw their homeland. The same is true in Homer'sthe Odyssey. Odysseus and his men

Narrative essay, fictional, "The first time I got Pulled Over"

853 words - 3 pages The First Time I Got Pulled Over                  Everyone gets pulled over by a cop eventually, but if you're one of the lucky ones that don't, well good for you. Authority figures are always intimidating, especially police officers and sheriffs. If you want to ruin your day deliberately, the best way to do it is get pulled over.         My traumatic incident all began about two summers ago. My day started out as any normal

Dramatic irony is used to create comedy in this play. Write an essay explaining the effectiveness of this literary device in the first act of the play, Twelfth Night" by William Shakespeare

723 words - 3 pages Tanya Hopker 26 February 2004Grade 10QLiterature EssaySection A: Number 1Dramatic irony is used to create comedy in this play. Write an essay explaining the effectiveness of this literary device in the first Act of "Twelfth Night".Twelfth NightIn the play "Twelfth Night" by William Shakespeare the playwright uses much dramatic irony. Dramatic irony occurs when the audience knows something in the play that the characters themselves do not know

Final Draft of the first essay assignment - Broward College ENC1101 - Essay

579 words - 3 pages Medina 2 Medina 1 Mellany Medina Professor Thibodeau ENC 1101 T & R 11-12:15 PM 7 September 2016 Essay 1 Assisted Suicides The main point of the article “Mercy and Physician-Assisted Suicide”, written by Kathryn E. Harvey, is that the introduction of physician-assisted suicide (PAS) increases the rate of non-assisted suicides and is not a justified way to die because it is not the plan that God had planned for you. The idea of PAS was brought to

The causes of the first world war - European history 1900-1985 - ESSAY

2020 words - 9 pages persisted. Within this context, a Serbian terrorist group known as the Black Hand would inevitably become the perpetrators of what many claim to be the ultimate trigger of the First World War; the assassination of Franz Ferdinand. Austria-Hungary used this assassination of their heir as an excuse to place a series of ultimatums on Serbia, and ultimately, declared war on the Slavic nation. What seemed to start as a conflict between two nations in Eastern

Title: "Earth's First Hero." This essay explains how ultimately Adam is the hero of Paradise Lost

1127 words - 5 pages flaws of the first man and woman in creation, Milton makes Adam, ultimately, the hero of Paradise Lost because Adam experiences growth, recognizes his and Eve's sin against God, and solidly maintains his love and revere of God.Milton's Paradise Lost is played out within 12 books, and the casting out of Adam and Eve from the Garden of Eden is the final resolution of the epic heroic verse. In Book IX, the fates of Adam, Eve and Satan disguised as a

This is a first person analysis essay on the Middle Passage Slave Trade

1167 words - 5 pages enough slack to rip my skin off and allow me to stumble forward. Aboard that ship I was forced into a hold built for about 300 people with 600 others, creating an unbearable heat as our bodies. When the ship pitched forth toward our destination cries of anguish filled the hold as we left our mother, Africa.Within the first few days there were already 17 suicides and the boat was rank with the stench of death and disease. My only refuge was the

Similar Essays

Jamaica Kincaid's Essay On Seeing England For The First Time

2318 words - 9 pages Jamaica Kincaid's essay On Seeing England for the first Time "It's shit being Scottish! We're the scum of the fucking earth! Some people hate the English. I don't. They're just wankers. We're the ones what were colonised by wankers. We couldn't even pick a decent bunch of people to be colonised by." -Irvine Welsh, Trainspotting The cultural ties to empire are not so easy to efface as the political ones. This is perhaps one of the

Beowulf Essay: The First

1393 words - 6 pages There are a plethora of different themes, motifs, and symbols to choose from in Beowulf. A recurring theme throughout Beowulf is generosity and hospitality, along with the importance of ones identity. One portion stands out the most against the first theme and it is; The Finnsburg Fragment. A motif that came to mind while reading Beowulf had to have been the importance of the Mead Hall. Something else to think about is the relation to the fall

The First Mediation By Descartes Unsw Essay

908 words - 4 pages The first mediation by Descartes, for me looks at the struggle of the human existence with their own mind. Descartes plays the role of what is to be a mediator who continually has trials and tribulations with himself. In the text a point that stuck out to me was the fact that, what we accept as most true is due to our senses. This means that we can only perceive what our senses allow us too. This I believe to not be true. If we were to look at

History Essay Regarding The Question: To What Extent Did The Feminists Of The 1920s (The First Wave Of Feminism) Achieve Its Goals?

2652 words - 11 pages Untitled The decade of the 1920s was a period of change. In Canada many famous and important events occurred during that time, for example Canada joined the League of Nations; The Indian Act was amended to give Canadian aboriginal peoples the right to vote; The Ottawa Senators won the Stanley Cup, defeating the Seattle Metropolitans. The discussed in the present essay is the first wave of feminism that was also taking place in that