The Zebra Fish And Human Diseases

1935 words - 8 pages

1.0 Introduction
1.1 Zebra Fish
The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8).
1.2 Polymerase Chain Reaction (PCR) and RT-PCR
Polymerase Chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated it is able to be copied as much as needed (2). In this experiment PCR was used to isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows:
5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’
5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’
Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2).
Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe expression levels of RNA (10). Using RT-PCR one is capable of identifying a predetermined gene (vangl2) via complementary Deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcribing its cDNA through the enzyme reverse transcriptase (10).
1.3 Gel Electrophoresis.
For our study, to visualize DNA Gel Electrophoresis is used. The concept behind Gel Electrophoresis is that it separates out DNA molecules according to their size. (3). The composition of the gel is very important as to why gel electrophoresis works. The gel is made of agarose (1% for our study) which gives DNA resistance while moving through the gel once an electric current is applied. DNA has a negative charge which is why once the electric current is applied that the molecules move towards the positively charged electrode (3). The pieces of DNA will continue to move until they meet their resistance in the agarose gel. The reason DNA move through the gel and stop at different points is due to the size variation amongst molecules (3).
1.4 Restriction Enzyme
A restriction enzyme is used to cut DNA at a specific nucleotide sequence better known as restriction sites (10). The activity sequence for this procedure is as follows: G
C
Vangl2 is roughly 13,800 base pairs long and in this experiment 400-500 pieces are trying to be isolated from the gene. For the experiment two Restriction enzymes were used:...

Find Another Essay On The Zebra Fish and Human Diseases

Overweight and Obesity: the New Endemic Diseases

1063 words - 4 pages , where numerous fatal diseases are included. If people had a better understanding of why it is important to eat and live healthy, and more importantly how to do so, obesity would surely decrease. This threat has to be taken seriously since it is growing too fast. New laws, education programs, healthcare and school policies have to develop if to stop the avalanche like widespread of obesity. Someone have to act, hard and soon. Do what it takes to

Potential of Discovery: The Robotic Fish and its Potential

1681 words - 7 pages risks out of sea exploration. Where some forms of ocean floor exploration involve people venturing down with limited resources and time, robotic fish take out the entire human risk of exploration. By cutting out the human factor you increase efficiency, availability, and ease of execution while directly proportionately decreasing the amount of below surface disturbance, cost of resources, and most importantly the possibility of fatality or injury

Imagery and Diction in The Fish by Elizabeth Bishop

1304 words - 5 pages Imagery and Diction in The Fish by Elizabeth Bishop Elizabeth Bishop's use of imagery and diction in "The Fish" is meant to support the themes of observation and the deceptive nature of surface appearance. Throughout the course of the poem these themes lead the narrator to the important realization that aging (as represented by the fish) is not a negative process, and allows for a reverie for all life. Imagery and diction are the

Paleopathology’s Depiction of Prehistoric Dental Diseases: Agriculture’s Negative Effects on The Human Time Capsule.

1794 words - 8 pages Teeth are the time capsules of the human body and serve as a marker of dental diseases, diets, and the oral hygiene of an individual. Teeth seem to be one of the most important found human remains in Archaeological sites and one of the most studied in Paleopathology. It is because of the fine preservation of teeth, in Archaeological sites, that we can study and depict the contributing factors that are the cause of dental diseases in prehistoric

Speech on different pathogens and the diseases they cause.

611 words - 2 pages Hello Everyone. I'm here to talk about the difference between prions, viruses, bacteria, protozoans, fungi and macro-parasites. These are all pathogens that cause diseases. I will also be giving examples of the diseases that these pathogens cause.Prions are infectious agents which do not have a nucleic acid genome. Prion diseases are often called spongiform encephalopathies (mad cows disease) because of the post mortem appearance of the brain

Link Between Smoking and the Ocurrence of Cardiovascular Diseases

1794 words - 7 pages Introduction Majority of people associate cigarette smoking and tobacco with lung cancer and breathing problems. However, in addition to these, smoking is a major cause of cardiovascular disease that is, blood vessel and heart diseases. Tobacco and cigarette smoking have been regarded as major risk factors for different chronic diseases Everett (2004). According to AHA (American Heart Association) cigarette smoking is seen as the most

Genetic Testing and The Diagnosis of Genetic Diseases

1389 words - 6 pages Genetic testing is used to determine the risk of a patient or patient’s offspring developing genetic diseases. This is done with DNA sequencing in adults and preimplantation genetic diagnosis (PDG) on embryos. These methods of genetic testing are effective means of determining the likelihood of developing diseases such as Huntington’s disease, a disease resulting from trinucleotide repeat on chromosome 4p16.3 that causes uncontrollable muscle

Describe, compare, and contrast the pathway of air in amphibians, Birds, Fish, and Humans.

1360 words - 5 pages is similar in both fish and humans in a few ways. First, both humans and fish need moist air. Second, they both have capillaries on a type of air sac that absorbs oxygen by diffusion.There are also many differences in the respiration between a human and a fish. First, humans use lungs, and fish use gills. Human “air sacs” are called alveoli, and fish “air sacs” are called lamellae. Fish cannot make their air moist, unlike

International Market/Product Profile for Ornamental Fish in Japan: Analysis and Recommendation for the Producer/Exporter.

3099 words - 12 pages Contents1.0 INTRODUCTION2.0 THE PRODUCT3.0 FOREIGN MARKET DEMAND4.0 MAIN COMPETITORS5.0 CHANNELS OF DISTRIBUTION6.0 THE FOREIGN MARKET7.0 TRADE EXPERIENCES BETWEEN PRODUCT COUNTRY OF ORIGINAND FOREIGN MARKET8.0 CONCLUSIONS9.0 RECOMMENDATIONS10.0 REFERENCES1.0 Introduction1.1 PurposeThe purpose of this project is to analyze the international market (Japan) that is of interest to the producer and exporter of ornamental fish. Specific

Prophylactic Antibiotics and the Vreation of Superbugs and Antibiotic Resistant Diseases

3868 words - 15 pages antibiotic, also contributing to the overall progression of superbugs and the decrease of antibiotic integrity against certain diseases and contagions. In her article “Antibiotic Resistance” Cheryl Wetzstein states that “Antibiotic resistance is a problem that humans have created through the misuse and overuse of antibiotics.” The reasoning behind this is many people don’t understand how antibiotics work in their bodies. Antibiotics are used to treat

Role of Metabolites in Diagnosing Chronic and Infectious Diseases and the Efficacy of Therapeutic Interventions

684 words - 3 pages These scenarios share the critical need to develop noninvasive, low cost techniques that can help make critical decisions that impact everything from health, quality of life, costs, and public health policy. There has been recent interest in understanding the role that metabolites may play in diagnosing chronic and infectious diseases and the efficacy of therapeutic interventions. Since the metabolites represent the current state of the

Similar Essays

The Similarities Between Humans And Fish

1117 words - 4 pages Human and fish are not closely related on the outside. Most people would not see how we can share same features with fishes, but scientists do know that these two species share homologous features. These features imply that human and fish are related in the lineage of chordate because human shared homologous features with fish. Homologous features shared by human and fish lighten up the evolutionary pathway from the earliest vertebrate by

At The Net: Game, Set, And Fish?

1145 words - 5 pages At the Net: Game, Set, and Fish?         Sorry Wimbledon fans, this is not about tennis. It is, however, about competition -- competition between many different competitors and played out on many planes. Some competitions are purely cerebral while others are brutally physical and usually end in death.         Fishing, like life, is a competition: It pits fishermen against fish, fishermen against the elements of nature

"Vector Organisms And The Diseases They Carry "

903 words - 4 pages Research paper about vector organisms such as ticks and mosquitoes and ways to remove them.Vector Organisms and the Diseases They CarryVector organisms are parasites that transmit various diseases. Two vector organisms are ticks and mosquitoes. These two vector organisms transmit many well-known diseases. Through most of this essay, I will be explaining these two different organisms and the diseases that they carry.First, I will be explaining

The Heart, It's Diseases, And Functions

1396 words - 6 pages impulses. Oneof the four chambers, right atrium, contains group cells called sinusnode. The sinus node acts as a pacemaker, which produces electricalimpulses that signal the muscle of the heart to expand and to contractin the pumping cycle. The heart rate of a human can get up to 200 beatsa minute if you exert yourself. If something goes wrong with the sinusnode and normal pacing of heart is disturbed or bothered, one of a numberof rhythmic disorders